Discover the best of the web!
Learn more about Digg by taking the tour.
Storing data in living organisms...
trnmag.com — The researchers used artificial DNA sequences to encode portions of the text of the children's song It's a Small World, added the sequences to bacteria DNA, allowed the bacteria to multiply, then extracted the message part of a DNA strand and retrieved the encoded information.
Gregd- 824 diggs
- digg it
- antron, on 10/12/2007, -5/+37Did they also get 42?
- DrGonzo1184, on 10/12/2007, -16/+1...
- Samsong, on 10/12/2007, -18/+2No, silly! What does 42 have to do with Disney?
- GoatBnn, on 10/12/2007, -3/+11Thats actually easier than you may think. Getting 'custom' DNA into bacteria is commonplace in Molecular Biology labs, look up cloning. You would just need a vector like puc and then any sequence of DNA you want. Close it up, make a circular plasmid and you are golden. Seems to me the trickiest part would not be coding the DNA and putting it into bacteria (seriously, 30 minutes), but translating English into the 4 letter alphabet of DNA...
- GoatBnn, on 10/12/2007, -4/+24"No, silly! What does 42 have to do with Disney?"
Dugg down for totally missing the hitchhikers reference...and you call yourself a geek... - Jo9100, on 10/12/2007, -2/+5- oh! i think i just got a virus !
/bad wordplay, sry for that - bIuebonics, on 10/12/2007, -0/+16"but translating English into the 4 letter alphabet of DNA."
well, we did it with binary, so you'd have to assume it'd be twice as easy with dna :P - daeken, on 10/12/2007, -1/+4def stringToDNA(string):
return ''.join([str((n >> 6) & 3) + str((n >> 4) & 3) + str((n >> 2) & 3) + str(n & 3) for n in [ord(c) for c in string]]).replace('0', 'A').replace('1', 'C').replace('2', 'T').replace('3', 'G')
Of course you could further optimize this by encoding just plaintext, but this will represent any string as DNA. - GoatBnn, on 10/12/2007, -2/+6More like ATTCCCGCTACGGTAACCTTAATATATAGCCGGATACGAATACGTAAGCCTTTTATAGTGTCTGATCTGATTAGGACTATCGTCCGATATAGCATCGATGCATGTATGACT
- dylanrjones, on 10/12/2007, -0/+11Eventually, if this catches on, certain phrases will kill bacteria by coding for defective proteins, and some might even confer advantageous properties. It will be interesting to see if any spooky correlations turn up. Like "George W Bush" translated into DNA might send all of the bacteria in the colony off to a pointless death, but remain safe in the affected bacterium itself, or the phrase "your mom" turns bacteria into a new STD
- GoatBnn, on 10/12/2007, -2/+2^^ You would have to have a promoter for that. Im sure the people doing this know better than to put a promoter before the sequence.
No promoter = intron. Introns get cut out. - dylanrjones, on 10/12/2007, -2/+2That's true, but I'm sure something might translate as a TATAA box.... I guess you're right. They wouldn't be that stupid
- EmperorAwesome, on 10/12/2007, -0/+2I wanna be a mnemonic courier!
- centic, on 10/12/2007, -0/+3Wouldn't putting this in cells that constantly replicate allow us to have an infinate number of backups?
- Flanker, on 10/12/2007, -0/+2goatbnn said "No promoter = intron. Introns get cut out."
Sure about that? More like no promoter = not transcribed, therefore nothing to cut out. Introns are transcribed and then cut out at the mRNA level because they're flanked by specific splice sites. - raindogmx, on 10/12/2007, -0/+2GATTACA!
oh i'm so dumb.
- earthtoandy, on 10/12/2007, -1/+15I saw this episode of Star Trek already.
crafty Klingons- archlich, on 10/12/2007, -1/+5me too, in Cowboy Bebop ~ Ein
- ohthedaysofyore, on 10/12/2007, -5/+3I saw this in an episode of Star Trek: Voyager the other day...
- earthtoandy, on 10/12/2007, -0/+5the timing of our comments is pretty funny.
also funny: how much star trek recycles plot lines
lets start a list on just this top.
the episode where the klingon has some code stored in his cells. Next Generation
The one where the puzzle was hidden in various species dna leading to a recording from therace that lead to all humanoids. -Next generation
apparently an episode of voyager... - ohthedaysofyore, on 10/12/2007, -0/+1Crap. It was probably one from TNG. =[ Oh well, I guess that's why you beat me to the punch. But I could have sworn it was on a Voyager episode...
I only get to watch Star Trek in between morning and night classes, so it's usually absent mindedly while doing home work. - chris86, on 10/12/2007, -0/+1The second episode of Enterprise had a Klingon carry information on the temporal cold war in his cells as well.
- earthtoandy, on 10/12/2007, -0/+5the timing of our comments is pretty funny.
- MikeKnoop, on 10/12/2007, -1/+3Would be an interesting way of hiding data. Soon your harrdrives will bear biohazard symbols!
-Mike - RoshanK, on 10/12/2007, -1/+2steganography * 10^ infinity
- defectDS, on 10/12/2007, -1/+9Load up some bacteria with spyware and let it loose.
- wnanette, on 10/12/2007, -1/+0defect DS-
...the Department of Homeland Security would just looove to hire you! :P
- wnanette, on 10/12/2007, -1/+0defect DS-
- flamingmb, on 10/12/2007, -0/+6Johnny Mnemonic?
- aks123, on 10/12/2007, -1/+4The unfortunate thing is that even this type of storage data is subject to viruses, and I mean real viruses.
- GoatBnn, on 10/12/2007, -1/+2Viruses may actually be one of the best ways to get this DNA into eukaryotic chromosomes...
- aks123, on 10/12/2007, -1/+2Yes, unless it's one of those virulent viruses that destroy the cell.
I see some problems with this, that the article did not address.
For instance, trying to make an antivirus program for this would be as hard as trying to cure HIV.
And DNA cannot be protected from mutations that arise from errors in DNA replication.
Seems like a pretty interesting and cool idea though. - GoatBnn, on 10/12/2007, -1/+4virulent virus? want to rephrase that? by definition a virus is virulent. if it wasn't virulent, it wouldn't infect anything and just be a useless protein shell.
"And DNA cannot be protected from mutations that arise from errors in DNA replication."
Definatly true, but the ratio is something like one error per billion nucleotides...which means its probably more secure than a moving HDD. You would just pick a high fidelity bacteria I guess..
speaking of HIV, shameless plug...
http://www.flickr.com/photos/30444354@N00/397086822/ - GoatBnn, on 10/12/2007, -1/+1^^ http://digg.com/health/Amazing_picture_of_HIV_inside_an_infected_cell
- aks123, on 10/12/2007, -1/+3Viruses can be either virulent or lysogenic. Virulent viruses are those that immediately use the host to make copies of itself, cut up the host DNA into pieces and burst out of the cell. Lysogenic viruses are those that incorporate their DNA into the host's DNA, and remain dormant until conditions cause it to become virulent.
(Sorry for being a bio geek, I'm taking microbiology right now, and my exam is in fact tommorrow) - GoatBnn, on 10/12/2007, -1/+1A virus is lysogenic or lytic. and those are just life cycles. both forms are virulent, just different paths of being virulent.
- WaterDragon, on 10/12/2007, -1/+3What I find really amazing is that at last, someone has discovered a way to make data susceptible to another kind of virus...an actual 'virus.'
. - MissTress, on 10/12/2007, -1/+0So now a Popup will mean something TOTALLY different and we can refer to spam as poop.
- HunterTV, on 10/12/2007, -1/+1Great, so if I sneeze near my bacteria flash drive does that turn all my vacation pictures from Vegas into vacation pictures from New Zealand?
- markp93, on 10/12/2007, -0/+3(spooky music in background:)
i wonder if our "junk dna" encodes anything...- GoatBnn, on 10/12/2007, -2/+1it does. how about promoters and enhancers?
- vsujohn2, on 10/12/2007, -0/+20"Hey man you got that new movie?"
"Yeh, hold on, let me take a piss."
Fire-sharing of the future- GoatBnn, on 10/12/2007, -1/+15if you are peeing cells, you should be thinking of other things than file sharing...
- SmokeyBong, on 10/12/2007, -0/+11Just one more place the RIAA is going to be tracking for piracy.
- GoatBnn, on 10/12/2007, -3/+7itunes will require a urine sample for every song downloaded.
- SmokeyBong, on 10/12/2007, -0/+2What if you get a virus?......
- Salmonized, on 10/12/2007, -1/+2porn will require a s***load....
- WaterDragon, on 10/12/2007, -1/+3"Fire-sharing." lol
- crashflow, on 10/12/2007, -0/+3fire-sharing
look, if it burns when you pee, maybe you should get a check up before you start sharing that on torrent. - Flanker, on 10/12/2007, -1/+1goatbnn said "if you are peeing cells, you should be thinking of other things than file sharing..."
Sure about that? It's perfectly normal to have epithelial cells which line the urinary tract slough off into the urine. I'd be surprised if someone had a completely *acellular* urine.
See Google or http://www.nlm.nih.gov/medlineplus/ency/article/003905.htm#How%20the%20test%20is%20performed
- SmokeyBong, on 10/12/2007, -0/+1Maybe in the future you can upgrade your brain memory? Store more useless ***** then every yay... good for mental images of porn.
- xabstract, on 10/12/2007, -0/+1bacteria activists are gonna have a hoot about this one
- Salmonized, on 10/12/2007, -1/+0"...to get data...please lick the yellow colored water....."
- D3koy, on 10/12/2007, -0/+15Storing data in living organisms?
Yeah, it called "asking someone to remember something for you" - WaterDragon, on 10/12/2007, -0/+1For an interesting flight of fantasy, consider ways that this new data storage technique might become misused by some totalitarian government or corporation.
- DeFex, on 10/12/2007, -0/+4The thing in the back of my fridge was so old it said FCKGW-RHQQ2-YXRKT-8TG6W-2B7Q8 when i scanned it.
- FAT_PIGGY, on 10/12/2007, -0/+2100 TB DNA harddrive cool
- inara23, on 10/12/2007, -0/+3The small world song needs to be erased forever from our musical consciousness, not preserved in strands of DNA, thanks very much.
- Shevanel, on 10/12/2007, -0/+0Anyone else see how this could turn in to the whole AI taking over the world scenario? They're using pretty much nuke proof living things to store human knowledge....This just spells disaster to me.....
- neko, on 10/12/2007, -0/+1I think this format might be too vulnerable to code injection exploits!
- neko, on 10/12/2007, -0/+3Also, does anyone else see the potential here for a whole new kind of P2P network so we can get the bacteria to infringe the RIAA's IP at exponential rates on a massive scale? =D
- guibom, on 10/12/2007, -0/+1Oh man... Neverwinter Nights did this sooo long ago
(obscure reference to the few that used Aurora Toolset to write any scripts) - JaggedEdge, on 10/12/2007, -0/+1Anybody watch Cowboy Bebop? Ein the "Data Dog" instantly comes to mind.
- peranadigital, on 10/12/2007, -0/+1Blade runner style for the new millenium
- cgruber, on 10/12/2007, -0/+1This is boring.. I have a basement full of Japanese kids memorizing PI and counting in binary.
- tdskate, on 10/12/2007, -0/+1Blu-Ray is dead.
- Andross07, on 10/12/2007, -0/+0Heard about this 5 years ago, Discovery Channel rules!
- finalblue, on 10/12/2007, -0/+1It'll be awesome if viruses or bacteria carrying DNA encoded with the lyrics "It's a small world after all" ends up becoming infectious and fatal to humans.
- echoforever, on 10/12/2007, -0/+1Oops! My password files escaped.
- anomalya, on 10/12/2007, -0/+1life is a system
- mello2ns, on 10/12/2007, -0/+0Those groups who say that there have been past civilizations with advanced technology might latch onto this news and propose that the unused DNA in humans may contain downloadable and decipherable data from previous times. So, will it be the next big sci-fi movie plot?
- reporterjason, on 10/12/2007, -0/+0As previously alluded to in the comments, this was done in Star Trek: The Next Generation. I happened to watch it last night, by sheer stroke of luck. Here are the details: In the episode called "The Chase." Four billion years ago, aliens sprinkled their DNA across 19 worlds. Stored in the genetic code were snippets of a holographic recording from the aliens explaining their cause. The Enterprise crew had to compete against, and finally cooperate with, both the Cardasians and the Klingons to put the code together.
- Tarnum, on 10/12/2007, -0/+1Dear, please feed the hard disk!
- supermanred, on 10/12/2007, -1/+1I just found a bunch of code in my OWN DNA!! It seems to be a mathematical equation. Hmmm it works out to 42.
- sixstring, on 10/12/2007, -0/+1This brings a whole new meaning to the term "live backup."
Digg is coming to a city (and computer) near you! Check out all the details on our 
© Digg Inc. 2008 —
Content posted by