digg

Join DiggAbout

Discover the best of the web!
Learn more about Digg by taking the tour.

Platypus genetic code FIGURED OUT!

chicagotribune.com — A team of scientists has determined the platypus' entire genetic code. And right down to its DNA, it turns out, the platypus continues to strain credulity, bearing genetic modules that are in turn mammalian, reptilian and avian.

Bury
show profanity settings
expand all
  • ColonelTribune, on 05/08/2008, -74/+9What's next? The dolfin? I hope they figure out why they're so damn smart.
    • failedprototype, on 05/08/2008, -1/+73For the love of everything good in this world, please tell me you intentionally spelled that wrong.
      • ColonelTribune, on 05/08/2008, -6/+30:Shrug: Even the Colonel makes mistakes. (Although I can't believe I made that one.) Feel free to bury me, if you haven't already. I deserve it.
    • sockpuppets, on 05/08/2008, -18/+4Dolls have fins?
      • sgtbutterscotch, on 05/08/2008, -0/+17I'm surprised at you sockpuppets. That was terrible.
        • inbred, on 05/08/2008, -0/+10Don't be alarmed, it's just a new writer he's hired into the staff.
    • otis12, on 05/09/2008, -2/+3Dolphin*
    • zspitfire04, on 05/09/2008, -3/+2The Dolphins aren't THAT smart, your just THAT dumb.
      • SasquatchBill, on 05/09/2008, -1/+3Your retarded.
        • Cloud7659, on 05/09/2008, -0/+3Go on......

          Your retarded...........what? Since it's grammar day on Digg, the correct phrasing would be "You're retarded." Your retarded would only be used as a fragment, sort of like "Your retarded cousin" or "Your retarded Sasquatch"
      • containimated, on 05/10/2008, -0/+1Me and him are gonna whack you in the labonza!
    • SymbolicChaos, on 05/09/2008, -0/+1So long and thanks for all the phish.
  • SeventhSon, on 05/08/2008, -2/+75I expected the mammalian and avian parts, but the reptilian caught me off guard.
    • Azimuth1, on 05/08/2008, -26/+8"There are genes for egg laying — evidence of the animals' reptilian roots."

      How is that evidence for reptilian roots when birds also lay eggs?
      • ElWizardo, on 05/08/2008, -1/+56Birds have reptilian roots.
      • Lyk4n, on 05/08/2008, -2/+5Evolution..
      • LongShlong, on 05/08/2008, -0/+34Jurassic Park will answer all your questions.
        • macweirdo42, on 05/08/2008, -2/+21God creates dinosaurs. God destroys dinosaurs. God creates Man. Man destroys God. Man creates dinosaurs.
          • TJacques, on 05/08/2008, -1/+6Dinosaurs... eat... men!
          • underdog138, on 05/08/2008, -3/+4... Man destroys dinosaurs. Man creates AI. AI destroys Man. AI creates AI.
          • chrispeters, on 05/08/2008, -1/+7AI creates Cake.
          • wrxpert, on 05/08/2008, -1/+6The Cake is a Lie!
          • TheHayze, on 05/09/2008, -7/+2Women inherent the Earth...
            D: sorry, had to be said. Tho albeit a little late.
          • Cloud7659, on 05/09/2008, -0/+3Inherit damnit, INHERIT!
      • Tyr7BE, on 05/08/2008, -0/+6The males also have the ability to inject poison via a claw on one of its legs - a trait usually reserved for reptiles.
      • Nomad83, on 05/08/2008, -0/+5Its the texture of the eggs as well, i.e. leathery or brittle, and the portion of the egg involved in development.
      • ausfahrt, on 05/08/2008, -0/+3Don't bury this comment it was a valid question and had a good answer. If it's buried the discussion that it spawned is lost.
        • Lewie, on 05/09/2008, -0/+2Agreed. I thought Digg liked science, which requires questions to be asked. Don't fail me Digg...
        • darkwing81, on 05/09/2008, -2/+0to many diggers stuck on stupid
    • Carmilla07, on 05/08/2008, -1/+24mammals evolved from reptiles. Just like birds also evolved from reptiles. Monotremes are some of the most primitive mammals so it makes sense that it would have reptilian genes.
      • Jacob, on 05/08/2008, -7/+1no... no... no... They did NOT evolve from reptiles. They evolved from common ancestry not the same thing at all.
        • khfn, on 05/09/2008, -0/+2How do you explain the the reptilian medulla of our lower brain?
          • herecomes, on 05/10/2008, -0/+2It's part of the Intelligent Design.
        • SharkyTech, on 05/09/2008, -0/+7No they didn't evolve from modern reptiles (which i think is your objection), but the common ancestor was still a reptile.
      • Cybersuchus, on 05/09/2008, -1/+9Actually, if we must get pedantic about it (and apparently we must), mammals branched off from the same group of animals that gave rise to reptiles and birds. So technically, mammals did not evolve from reptiles. The fact that the platypus shows some distinctly "reptilian" characters tells us that these characters are actually older than reptiles themselves, and was inherited by both animal groups.
        • gordonj, on 05/09/2008, -0/+4You are talking about extant reptiles, but the first synapsids were reptiles too, so technically mammals did evolve from reptiles, albeit ancestral ones.
    • samw1ns, on 05/08/2008, -1/+3crikey mate!
      • FatLoser, on 05/09/2008, -10/+1Lol, reminds me of something a guy named Steve Irwin used to say before he got killed by a stingray. Thanks for desecrating his memory.
        • infinitiesedge, on 05/09/2008, -1/+1Steve Irwin was a douche... (Australian)
      • darkwing81, on 05/09/2008, -2/+0ill stick my finger in its bum and SEE WHAT HAPPENS!
    • ubuwalker31, on 05/08/2008, -3/+2Go Bears!
    • phenom2k7, on 05/08/2008, -6/+1Whilst checking out http://digg.com/world_news/Incredible_picture_of_C ... I came across a similar article about the Platypus here, with decent pics for those wondering wtf it was :
      http://www.dailymail.co.uk/pages/live/articles/new ...
    • markp93, on 05/08/2008, -1/+2V
    • cjh24, on 05/08/2008, -0/+5Playpus' didn't evolve from birds, they are mammals.
      Mammals evolved from reptiles, as did birds.
    • tsotha, on 05/08/2008, -0/+3I agree, but how many mammals actually use poison like the platypus does?

      Australia has some weird fauna, that's for damn sure.
    • sanman, on 05/09/2008, -0/+5"On the next Maury..."
    • chijim70, on 05/09/2008, -0/+1Figured out? To me that article GNDN (goes nowhere, does nothing).
    • theshiz892, on 05/09/2008, -0/+1The eggs they lay are similar to that of a crocodile and other reptiles which are soft-shelled.
    • Varz, on 05/09/2008, -0/+2Birds and Mammals are both branches from Reptiles.
  • displaced1, on 05/08/2008, -1/+278Mammalian, reptilian and avian.....that must of been one hell of a threesome.
    • dan360man, on 05/08/2008, -2/+84What happens in the air, on land or in the sea stays in the air, on land or in the sea.
    • Lyk4n, on 05/08/2008, -2/+19Giggity gig.
      • nerdherder, on 05/08/2008, -1/+7...ity. There I finished it for you.
        • Silentnite85, on 05/08/2008, -0/+10That's what she said.
        • Llanowar, on 05/09/2008, -1/+3This must be the best "that's what she said" I read in a long time.
    • skidme, on 05/08/2008, -2/+21've
    • Wonderama, on 05/08/2008, -1/+41Wow. We got from discussing platypus DNA to a threesome joke in no-time flat.
    • 4abtrlife, on 05/08/2008, -10/+0I'm sorry man, I meant to give a thumbs up and I hit the wrong button and buried you instead. What a sin I have done, buerying someone that was already displaced.
    • Synova, on 05/09/2008, -1/+5Half man...half bear...half pig.
      • gcnaddict, on 05/09/2008, -1/+2forgot the duck and the alligator, mate.
    • GuacamoleSan, on 05/09/2008, -0/+5It stores snake venom in its legs? Is that weird to anyone?
    • biggdeedubb, on 05/09/2008, -0/+3So a girl, a duck and a gecko walk into a bar....
  • AlwaysAwake, on 05/08/2008, -10/+23Mother Nature doen't know about rules, expectations, nor intellectual process. Just busy changing everything, at every moment. We are mostly caught in the movement of our own minds by choice, and not paying attention to this real movement.
    • tattertech, on 05/08/2008, -1/+11Actually, it knows rules quite well. We're just working out what those rules are. Mother Nature has some problem breaking the fundamental rules of physics (and chemistry by extension).
      • DiscoLando, on 05/08/2008, -3/+2Rules implies teleology, and that's anathema - if you're a naturalist, that is.
        • CamperBob, on 05/08/2008, -2/+2Does 2+2=4 imply teleology in your framework?
          • DiscoLando, on 05/09/2008, -1/+3Actually, yes, considering that the reality of abstract objects and the logic required to manipulate them also point to teleology. In other words, naturalism has a pretty hard time explaining their origin.
        • tattertech, on 05/10/2008, -0/+1You're stretching the definition of rules from what I meant. Significantly so in fact. In fact, the idea that there are certain things that are possible and certain things that are not has nothing to do with teleology. This sounds like you're suffering an astute case of a little knowledge is a dangerous thing...
    • DiscoLando, on 05/08/2008, -0/+6That's deep, Earl.
    • compcarp, on 05/08/2008, -12/+5Why is it Evolutionists insist on using the mystical figure of "Mother Nature" - sounding like school children.... but get all bend out of shape whenever someone points out the possiblity of an Intelligent Designer?
      • CamperBob, on 05/08/2008, -8/+3Because Nature's demonstrably real, with attributes that can be described, questioned, and independently observed.
        • compcarp, on 05/08/2008, -12/+2Can you put 'nature' in a jar? No. Because "Nature" as a term is just as etherial as a Creator. You see the parts of nature, just as I can see the handiwork of a Creator IN nature. Show me the pyramids and while we can debate over who created them - we can agree someone did. Nature is the same - however, that logic suddenly seems to escape evolutionists.
          • CamperBob, on 05/09/2008, -3/+3The entity you call "someone" -- meaning, the humans who built the Pyramids -- is just the latest link in a long chain of "somethings."

            Using the ubiquitous energy from the sun at every step, atoms create molecules; molecules create amino acids; amino acids create proteins; proteins create cells; cells compose animals; animals lead to humans; humans create pyramids.

            That is *way* cooler than your notion of an invisible old man in the sky with an all-too-visible attitude problem. You took the first answer, the obvious answer, the easiest answer, and went away happy. Not all of us are that easily satisfied.
        • davdev, on 05/08/2008, -1/+11It's called a metaphor. No one who believes in science actaully belives in a physical Mother Nature.
    • desertDenizen, on 05/09/2008, -0/+1Platypus: "I qwack all over your paradigm, bitch."
  • casspa, on 05/08/2008, -3/+68Disclaimer: 1) a renunciation of any claim to or connection with; 2)
    disavowal; 3) a statement made to save one's own ass.
    Though it'll go without saying ten minutes or so into these preceedings,
    View Askew would like to state that this film is from start to finish a
    work of comedic fantasy, not to be taken seriously. To insist that any of
    what follows is incendiary or inflammatory is to miss our intention and
    pass judgement; and passing judgement is reserved for God and God alone
    (this goes for you film critics too...just kidding).
    So please before you think about hurting someone over this trifle of a
    film, remember: even God has a sense of humor. Just look at the Platypus.
    Thank you and enjoy the show.
    P.S. We sincerely apologize to all Platypus enthusiasts out there who are
    offended by that thoughtless comment about Platypi. We at View Askew
    respect the noble Platypus, and it is not our intention to slight these
    stupid creatures in any way.
    • cgruber, on 05/08/2008, -1/+4christ and hear I just looked that up on Imdb to post it
    • JorgeGT, on 05/08/2008, -1/+6Whose house? Run's house! Whose house? (Say whay?) Run's house...!
  • alkajazz, on 05/08/2008, -1/+13By the Cosmos!
    • wontstoptalking, on 05/08/2008, -0/+15Great Scott!
    • petebot, on 05/08/2008, -0/+3By the goddess, Shepard!
    • jake8689, on 05/08/2008, -0/+6Oh My Science!
    • petebot, on 05/08/2008, -0/+1Oh my stars and garters!
    • davdw001, on 05/09/2008, -0/+2Holy hemorrhoids, batman!
    • jdubdub, on 05/09/2008, -1/+1Good news everybody!
    • Lewie, on 05/09/2008, -0/+2Holy schnikes!
    • desertDenizen, on 05/09/2008, -1/+1Updated Lord's Prayer:
      Our collective consciousness, who art in multiverse, bitchin be it that is nameless. What will be will be, a blend of intent and stochasticity, on terra as it is out-thera. Give us this day our three daily protein shakes. And pardon the occasional *****, as we try not to ram those who ***** against us into the guardrail. And lead us not to Vegas, but deliver us from Bush. For ours is Disney World; solar, wind, and pebble-bed nuke; and the glory; until the Big Crunch or maximum entropy. And how.
  • EvansHall, on 05/08/2008, -1/+138I am not smart enough to make a joke about this ...
  • pianonotes1010, on 05/08/2008, -4/+23Life will find a way
    • badassninja, on 05/08/2008, -8/+1You are a digital pimp son!
    • Merendino, on 05/08/2008, -6/+6Dugg for Jeff Goldbloom reference.
      • jackalsclaw, on 05/08/2008, -2/+5Buried for the Jeff Goldbloom reference
        • Samohtneas, on 05/09/2008, -0/+2Buried to counter bury the bury of his digg and dugg for the original digg.
    • DiscoLando, on 05/08/2008, -0/+6No, Steven Spielburg will find a way.
    • thepretext, on 05/08/2008, -0/+9You breed raptors?
    • indigit4l, on 05/08/2008, -1/+4Must digg down faster
    • RobbleRobble, on 05/09/2008, -0/+1Dun duuun, dun duuun, dun dun duuun dudun dun duuun! Dun dun dun dun, dun dudududun duuun, dududun duuun...
  • skidme, on 05/08/2008, -33/+19They're avian/mammalian/reptilian because God intelligently designed them that way. Could evolution have done that? I don't think so!

    /super-duper sarcasm
    • skidme, on 05/08/2008, -22/+11The people that digg me down have probably lost their sense of humor through years of selective inbreeding.
      • BedPost, on 05/08/2008, -7/+6Well, I dugg you down because I'm tired of the joke, and referring to ID, even sarcastically, gives it more credibility than it deserves.
      • infectthefrets, on 05/08/2008, -6/+4No, you're just stupid.
      • 3gibberish4q57, on 05/08/2008, -3/+23To be honest, I dugg it down because of the phrase "super-duper".
        • Merendino, on 05/08/2008, -1/+10I dugg you up because of your digg down.
        • DiscoLando, on 05/08/2008, -2/+8... and I dugg Merendino because of his digging up of the digging down.
          • NeoNevermore, on 05/08/2008, -1/+7I dugg your comment because of Merendino's digging up of the digging down but then I created another account just to digg everyone down.
          • davidamerland, on 05/08/2008, -1/+5This deserves digging up!
          • Shadow120, on 05/08/2008, -1/+6Now I have no idea what I'm digging and dugging and who's what is what's who how why where and when?
    • whereiseljefe, on 05/08/2008, -6/+3Thuper Serial!?
    • Unriggable, on 05/08/2008, -1/+6We're sorry, but there's no intelligence allowed here.
  • ironicsans, on 05/08/2008, -0/+25Duck billed platypus has feet like a duck but is furry. It's all in my Wildlife Treasury!
    • petebot, on 05/08/2008, -0/+3Whoa that commercial was taking up valuable space in my brain, lying dormant and waiting for only the slightest of reference to be pulled to the forefront again. Weird.
      • wolferz, on 05/08/2008, -0/+7Little known trivia. Our brains never forget anything they process... no matter how mundane. We just forget how to access the info.
        • MadOtaku, on 05/09/2008, -0/+2More specifically, if the pathways to access the info aren't used often enough, they degrade and fewer pathways to a memory exist. This leads to it 'fading away' since fewer things will trigger your remembrance of it. You could say we forget something if all the pathways were to erode, but I don't know if that ever happens.
    • McHoffa, on 05/08/2008, -0/+2a common commercial run during Mr Wizard.... ahh childhood...
  • alpha19, on 05/08/2008, -1/+37Finally I can sleep at night...
  • pedepy, on 05/08/2008, -3/+33i hear it also has ties with rev. Wright.
    • davidamerland, on 05/08/2008, -1/+1And was caught last winter clubbing seals off the shore of Alaska!
  • verifex, on 05/08/2008, -0/+13http://www.chicagotribune.com/news/chi-platypus-ec ...
    The story without all the irrelevant pictures and advertising.
  • unravelled, on 05/08/2008, -0/+34Can someone paste the code so we can pizz off the MPAA again?
    • SpookyPig, on 05/08/2008, -0/+35TATATATATATATATACGATGTCGTAGTCGTAGTGCGGCTGATGCTGATGTGATGCTGAAAAAAAA
      TATATATAGTGCTAGTCGTAGTCGTAGTGCGGCTAGTCGATATGAGCTGTCTGATCGTATAAAAAA
      and so on, and so forth.
    • Suprfire, on 05/09/2008, -0/+4TAC WTF CGA

      repeating.
    • pinchies, on 05/09/2008, -0/+4GTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTA

      I really gotta stop playing this game...
    • SolidSnak, on 05/09/2008, -2/+3OGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGCOGC

      yes, I went there.
  • ConanTL, on 05/08/2008, -4/+12God's ***** with us ;)
    • OnlyGirlOnDigg, on 05/08/2008, -0/+3Right Bill. Just think of one word: Dinosaurs
    • milkmage, on 05/08/2008, -0/+3no. that's what turtles are for
    • PixelMagic, on 05/08/2008, -2/+2What if God smoked cannabis?
      Do you suppose he had a buzz,
      When he made the platypus?
  • Kisama, on 05/08/2008, -1/+18Oh my Science!
  • iloveazngurlzs, on 05/08/2008, -0/+8i don't get it tho. Why would that creature be so few and far between. Its clearly dominant to most creatures, why doesn't anything else have a make-up like it?
    • macweirdo42, on 05/08/2008, -0/+12Because no matter how dominant it is, there is one problem - it looks freakin' ridiculous. How are you supposed to take a creature like that seriously? Hell, I know it has poisonous talons and all that and could easily kill me, but I still can't take it seriously!
      • ApokalypseNow, on 05/08/2008, -0/+9Actually, the poison, while extremely painful, is not lethal to humans.
        • macweirdo42, on 05/08/2008, -1/+11Well, good to know, but it'd probably still kill me - I get slashed, I collapse in pain, it then slashes open my jugular, and I bleed to death.
    • wolferz, on 05/08/2008, -0/+4uhm... clearly dominant how? I'm pretty freaking sure it is no where near the top of any food chain. Not to mention the platypus is only native to Australia and, given that it likes water... and Australia is mostly desert and grasslands... yeh no wonder it doesn't spread more. Plus, unless I'm mistaken, they don't reproduce all that often.

      As for the methodology being a better one... Typically the most successful animals in nature are the ones that do one or two things and do them well. Humans capability to dream and reason, the sharks ability to find and kill prey in the vastness of the oceans, the big cats' (lions, tigers, cheetahs) ability to ambush their prey, ants' organizational and building capabilities, etc. This swiss army knives approach tends to work some what poorly as the resulting creatures can never really find a niche that they can survive in, much less thrive. The platypus' only saving grace is the unique environment it finds itself in (Australia)
      • Woolmonkey, on 05/09/2008, -0/+4That's true of all Astralian creatures they thrive because they are in Australia. The introduced animals are wiping the floor with the native species.
    • Disregard, on 05/08/2008, -1/+5It is a furry poisonous duck, the special ed student's attempt at intelligent design.
    • StaticThunder, on 05/08/2008, -0/+4Everything that was almost a platypus went extinct, well, except for echidna.

      And wouldn't you want to too, if you were a furry poisonous almost-chicken?
    • Suricou, on 05/09/2008, -0/+1I think it fills a niche somewhere similar to the beaver, apart from being less edible due to the poison thing.
  • Merendino, on 05/08/2008, -5/+10So evolution does exist.... hmmmm.
    • CrazedLeper, on 05/08/2008, -34/+2Yeah, not. You have been given every reason to believe that intelligence was absolutely necessary *except* for the one reason you say you'll except (because you're pretty sure you won't get it). You see what you want to see and believe what you want to believe. Neverlution is crap and this story is just one more grain of sand in the hourglass that is counting down to the day you're forced to face the truth.
      • scubaman5000, on 05/08/2008, -1/+23You sir are an idiot.
      • ApokalypseNow, on 05/08/2008, -1/+17"You have been given every reason to believe that intelligence was absolutely necessary"
        Name one reason.
        • CrazedLeper, on 05/09/2008, -8/+3I'm willing to bet the ranch that you believe you're intelligent. Care to tell me which of the 4 fundamental forces (gravity, electromagnetism, weak nuclear, strong nuclear) can be attributed with this quality? Your minuscule intellect must be as a drop from an ocean yet you say no such ocean exists?
          • StaticThunder, on 05/09/2008, -0/+8Which one is working in my brain? Oh right, that would be electromagnetism. So it sure seems that matter (itself possibly just a manifestation of fundamental forces) under the influence of electromagnetism displays intelligent behavior.

            Electrons sense their environment and behave appropriately. Put two of them together and they interact according to logical rules.
          • ApokalypseNow, on 05/09/2008, -0/+3@Crazed
            You didn't answer my question.
          • Mnementh2230, on 05/10/2008, -1/+1Buried for avoiding the question. How about getting some intellectual testicles and answering AN's question?
          • CrazedLeper, on 05/10/2008, -2/+1@ApokalypseNow
            I did answer your question. From where does the drop come if no ocean exists? Intellect must have a source since it is not accounted for in physics, it must not, therefore be "physical". Something else *must* exist to account for it and that something else must have intelligence in order to account for the existence of the same.
          • ApokalypseNow, on 05/13/2008, -0/+3@crazed
            Intellect does have a source - our biology.

            "Something else *must* exist to account for it and that something else must have intelligence in order to account for the existence of the same."
            Do you have evidence to back that up, or are you just talking out of your ass again? You're taking an unevidenced metaphysical cop-out.
      • StaticThunder, on 05/08/2008, -2/+15Evolution is intelligent. Very few seem to understand what intelligence means. Intelligence means that you search for solutions to problems. Thats ALL it is. Its not some magical thing. You can search with a neural net (which is generally a nonlinear regression) or you can use case based reasoning, or bayesian inference, whatever, but ultimately even a random walk that evaluates each position on the space it traverses against some criterion is an intelligent process.

        Evolution searches for solutions to the problem of reproductive fitness. It doesn't have a brain, but it doesn't matter. Every living organism is a potential solution being tested.

        People keep saying life looks designed. IT WAS! By selection for reproductive fitness!
        • CrazedLeper, on 05/09/2008, -10/+2spin. Attrition alone cannot account for the existence of the staggering variety of life forms observable on earth. Nice try. Also, your crackpot theory has no beginning. Don't spin that too and say "who created God?" because that does not provide an answer to the question I posed.
          • StaticThunder, on 05/09/2008, -1/+8"My" theory doesn't really care what you think of it, it stands every test we've thrown at it for 150 years.

            And if everything needs a creator, so does God. The flaw is with your assumptions and incessant need to have an answer even if its at odds with reality. I don't know everything, but if you do, why do you care so much what I think if you've got a model of the universe that works?

            And now please don't get all presuppositionist on me, or I'll have to ask why we are talking since reason then wouldn't matter.
        • Varz, on 05/09/2008, -1/+5Thank you for bringing that out.
          People who don't understand the theory think that evolution implies something magically changing into a new species, they don't understand the process of natural selection, the force doing the 'designing'.
      • TheCheeks, on 05/09/2008, -2/+3Uh, im not that intelligent so i dont really see what your getting at, but couldnt i say to you the same thing, that YOU see what you want to see and believe what you want to believe. God is crap and is just one more grain of sand in the hourglass that is counting down to the day you're forced to face the truth of evolution?
      • Tyrghast, on 05/09/2008, -1/+5At least I don't chatter incessantly to an invisible man to please change the laws of nature in my favor...
      • chrgrose, on 05/09/2008, -2/+4This is why, eventually, religion will be extinct. Progress can only stand so much ignorance.
      • Varz, on 05/09/2008, -1/+3You have no proof.
        The theory of evolution was developed by scientists and has a foundation in LOGIC AND ACTUAL EVIDENCE.
        Seriously, Christianity and all other religions are all equally veritable, they all have NO PROOF AND FOLLOW NO LOGIC.
        If you aren't going to offer any proof for why your 'God' made everything then please SHUT THE ***** UP.

        What sounds more logical, the gradual change in species over time due to natural selection (which is a process proven to exist).
        Or some magical fairy man coming down out of no-where and instantly making everything a few thousand years ago.

        Oh yes and there is no proof for the existence of the fairy man beyond a fantasy novel written over a thousand years ago. Evolution has supporting evidence in the form of transitional fossils, vestigial parts, genetic comparability, micro evolution and the list goes on.
      • DrywallThief, on 05/09/2008, -1/+3lol @ neverlution

        What a noob.
    • Hetman, on 05/08/2008, -2/+13Crazedleper. I like you a lot. You give me endless amounts of joy with the statments you make. I would not want to be around you in real life but your posts are always amusing. And did you come up with that neverlution saying all by yourself or did one of your orign websites make it up for you?
      • Fergy, on 05/08/2008, -0/+5he must have discovered it on his favorite site: http://www.discovery.org/
      • Hetman, on 05/08/2008, -1/+9LOL that is the greatest site I have ever seen. I love this article title.

        Peer-Reviewed & Peer-Edited Scientific Publications Supporting the Theory of Intelligent Design (Annotated)
        By: Staff
        Discovery Institute
        July 1, 2008]
        The great thing is if you look at the annotated bib you see that it is not reviewed by any real scientist just other ID supporters. That is like me justifying racism because the rest of the kkk has reviewed my article and supports it.
        • compcarp, on 05/08/2008, -14/+3"The great thing is if you look at the annotated bib you see that it is not reviewed by any real scientist just other ID supporters."
          Yea, very funny until intellectual honesty points out the built-in bias of that statement. How easy life must be to be able to revoke someone's 'real scientist' club card the minute they disagree with you.
          • scubaman5000, on 05/08/2008, -2/+10You sir are also an idiot
          • StaticThunder, on 05/08/2008, -1/+13That presumes that someone was at one point a member of the real scientists club. Generally that requires having a dedication to facts, reason and knowledge of epistemology.

            You can say its elitist until you're blue in the face; real scientists test hypotheses by experiment. Pundits and charlatans start with conclusions and then badger, cajole, sue, threaten and appeal to popularity until people agree with them.
        • CrazedLeper, on 05/09/2008, -11/+1I can think for myself. I do not require marketing devices like lab coats and diplomas issued by self-appointed geniuses. There is far too much going on on planet earth to be accounted for by any amount of unguided activity. Also, ridicule is not evidence but Neverlutionists seem to keep it in plentiful supply. Keep following the crowd; that's bound to turn out well.
          • StaticThunder, on 05/09/2008, -0/+8You are the one following the crowd. I have a lab coat and a diploma. I know how to answer questions with the greatest likelihood of being correct; by testing the universe to see how it behaves. I don't see all this "guided" activity of which you speak other than the influence of natural laws which really don't care whether you pray to them or not.
          • chrgrose, on 05/09/2008, -0/+9Well we scientists like to have fun too. As a geophysicist/geochemist I just can't help laughing when someone suggests the entire planet is a few thousand years old. Its like saying the sun is powered by wood or the earths rotation is the consequence of 5 million pound gerbles. Its retarded, and so is the cognitive inhibitor and anti-empirical mockery of science and all epistemology--intelligent design.

            And BTW, my lab coat isn't for looks. It has a purpose... doh..
          • eir574, on 05/09/2008, -0/+6"I have a lab coat and a diploma."

            I'm suddenly feeling inadequate. I don't have a lab coat, and I can't remember where I put my diploma. I do suspect that wherever it is, it might smell a bit like gummy bears due to some poor decisions I made about where to store it after I finally picked it up from the registrar's office.

            Maybe tomorrow at group meeting I'll demand that the bioinformaticians be provided with lab coats. And gloves.
          • TheCatsPants, on 05/09/2008, -0/+5@eir574
            "'demand that the bioinformaticians be provided with lab coats"
            You too huh? Didn't think there'd be any other bioinfy diggers out there. /*waves*/
          • StaticThunder, on 05/09/2008, -0/+4Well, if you get a lab coat, make sure its the Tyvec kind with the wires woven into it to discharge static. I mean, if you're going to work around machines, you should do it in style.

            I can't remember the last time I wore mine... but I do have one.
          • eir574, on 05/09/2008, -0/+4@TheCatsPants:

            "Didn't think there'd be any other bioinfy diggers out there."

            We're basically techophiles who sit at computers all day, so I'd be surprised if we're the only two here. I've developed a bad habit of turning to digg every time I have to wait a couple of minutes for code to run.
          • TheCatsPants, on 05/09/2008, -0/+6@eir574
            Me too. I've developed the attention span of a gnat because of it though.
          • eir574, on 05/09/2008, -0/+3@The CantsPants,

            So true! After mastering self discipline in graduate school, I can no longer sit back and wait even 30 seconds for code to run before turning to digg, let alone find something else to do if it's going to take a few minutes. Fortunately, I still look good compared to the idiot in the cubicle next to mine, who literally asks other people to debug his code before even trying to do it himself.
          • eir574, on 05/09/2008, -0/+3@StaticThunder:

            "Well, if you get a lab coat, make sure its the Tyvec kind with the wires woven into it to discharge static."

            Cool! My building at work has a huge problem with static electricity. I've been shocked by cubicle walls and even by a plant. I also got three pretty significant shocks within a week's time from the same light switch, and over the weekend at home I realized that I had become afraid of light switches and was handling them very gingerly. I never knew that I'm so easily trained!
        • Malchus89, on 05/09/2008, -1/+1The KKK published that article?
    • jimminy, on 05/08/2008, -4/+9Was there ever a doubt?

      People really shouldn't treat creationism as if it even remotely could be true. In reality there is nothing controversial or mystic in evolution theory, and on the other hand creationism is pure religion with no evidence whatsoever.
      • ralphie81, on 05/08/2008, -8/+5Depends on how you define evolution, but really the two can co-exist and neither side has to be wrong.
        • StaticThunder, on 05/08/2008, -2/+8No, not really. If we were created there should be evidence of it, and no one has found any not pointing to evolutionary processes as being the creator.
          • ralphie81, on 05/08/2008, -3/+1What evidence would that be, exactly?
          • StaticThunder, on 05/08/2008, -0/+5For what? Evolution? Try googling. I'm not going to have the evolution has lots of evidence argument for the 200th time. Talkorigins.org.

            For creation? Well, I think producing the designer would be a good start. If not that, then some living thing that was not built for reproduction but to solve some other problem. Perhaps an animal that wants you to eat it, because it was created to satisfy your hunger.
          • ralphie81, on 05/08/2008, -7/+2For creation. Isn't the creation enough evidence of a creator? If I look at a computer, I think someone must've put that together. I don't demand to know who or why, or need to see all the tools that were used in creating it, I just assume logically that someone made it.
          • ApokalypseNow, on 05/08/2008, -1/+7@ralphie81
            "Isn't the creation enough evidence of a creator?"
            You are working off the flawed assumption that someone must be responsible. Look at the intricate crystalline structures in snowflakes - was a person responsible for those? No, just some basic chemical and thermodynamic properties acting out.
          • scubaman5000, on 05/08/2008, -2/+8Ralphie81 ok I'm going to introduce you to he scientific method. You've already covered the first steps. You've made an observation: there's things on this planet that are alive. Now you've presented a hypothesis: God did it. Ok the next step is to form an experiment and try to falsify your hypothesis...where are the holes in your argument...could you be wrong? This step is hard so I'll help you out. http://en.wikipedia.org/wiki/Endogenous_retrovirus take a look at that link. I know they use a lot of big words so let's go for something easier... hmmmm. How about this... http://en.wikipedia.org/wiki/Chromosome_2_%28human ... This link explains how chromosome 2 in all humans is actually the end to end fusion of chromosomes of our ancestors the great apes. If God did indeed create everything than he did so on a molecular level to intentionally deceive us into thinking that we evolved from something else. God is not supposed to be a deceptive guy so really we just found evidence that seems to be pretty definitive evidence that God wasn't involved... your hypothesis seems to have some holes in it.
            Ok how about the phylogenetic tree... everything seems to fit in place perfectly, hmmm the fossil record? Evidence of an evolution of creatures based on strata that is uniform throughout the entire planet. Ok vestigial features on animals... you know you have a tail bone right. Ok ok let's see...how about the fact that we can determine what a certain organism is on the phyolgenetic tree simply by looking at certain gene sequences that are consistent with other organisms they evolved from? I could go on and on and on...
            Time to start over with a new hypothesis. Just remember to keep going with experimentation and find that supporting evidence.
          • ralphie81, on 05/09/2008, -2/+2@Apokalypse
            If I thought that someone or something was responsible for human life, wouldn't I also think that someone or something was responsible for setting the chemical and thermodynamic properties of crystalline structures?

            @Scuba...I took science classes, thanks. Is your condescending tone supposed to make me eager to learn the "truth"? If so, it's not working. All I did was make a simple suggestion that different biogenesis theories should be considered since none can be proven and I got attacked. I never said I didn't believe in evolution, or that I did believe in God (I didn't mention God at all, you did), and yet for simply saying that the two can co-exist, I get treated as a naive, Bible thumping hick who doesn't know the difference between a Bible and a science book. For someone so into "facts", you sure assume a lot.
          • scubaman5000, on 05/09/2008, -1/+3"Isn't the creation enough evidence of a creator?"
            "I didn't mention God at all, you did"

            Creator = God, and can be used interchangeably in my arguments.

            You didn't make a suggestion that different biogenesis theories should be considered. You said "Isn't the creation enough evidence of a creator?" That is not a theory. That is completely useless nonsense given that the evidence I've presented clearly demonstrates that we as a scientific community world wide are long past dealing with the notion that a creator was involved in evolution.
            Unfortunately due to the nature of Digg this conversation is pretty much coming to an end. However I'd like to invite you to watch some videos on the subject. http://www.youtube.com/user/DonExodus2 Don't worry he's not as condescending as I am and he actually believes in God as well which I do not, which you may find comforting. However he has a very clear understanding of evolution and he explains it quite clearly. It's well worth watching.
          • StaticThunder, on 05/09/2008, -1/+6"For creation. Isn't the creation enough evidence of a creator? If I look at a computer, I think someone must've put that together."

            Circular reasoning. How many universes have you looked at to judge which ones were designed. When a rock falls off a mountain, I don't look at it and say, see how the forces of wind and erosion designed that rock? But if I had only seen one, and it was smoothly polished, I might think incorrectly that someone had purposefully made it that way.

            You've seen people make computers - or at least been told that they do. You have the benefit of 20/20 hindsight to say it was designed. The only way I would know for sure without the backstory is to say very seldom does nature make things with perfect right angles.

            The Universe doesn't have a lot of right angles in it.
          • ApokalypseNow, on 05/09/2008, -2/+4@ralph
            "If I thought that someone or something was responsible for human life, wouldn't I also think that someone or something was responsible for setting the chemical and thermodynamic properties of crystalline structures?"
            And do you have evidence for this? That something exists is not evidence for someone making it.
          • ralphie81, on 05/09/2008, -5/+2"You've seen people make computers - or at least been told that they do."
            Does being told that something happened make it true? Because I've also been told by quite a few people that God created the heavens and the earth.
          • ApokalypseNow, on 05/09/2008, -1/+4@ralph
            There is plenty of tangible evidence to support the fact that people make computers. There is NO TANGIBLE EVIDENCE to support the existence of the supernatural.
          • eir574, on 05/09/2008, -0/+6@ralph and AN,

            "There is plenty of tangible evidence to support the fact that people make computers"

            Furthermore, there is *direct* tangible evidence to support the fact that people make computers. We know with 100% certainty that if we want to, we can go watch someone make a computer or even build one ourselves (with appropriate technical knowledge or guidance from someone else who has the appropriate technical knowledge).
          • StaticThunder, on 05/09/2008, -2/+4"Does being told that something happened make it true? Because I've also been told by quite a few people that God created the heavens and the earth."

            For ***** sake use your brain. You've been told because you see pictures of them being made, you can go to a library and read how they are made, you can talk to the people who make them if you wish - LOTS OF EVIDENCE.

            This isn't I found a 2000 year old book claiming that computers were divinely created, destroyed by men, then 3 days later flew around to be seen by people apparently functional, and no one can figure out how that is possible without a miracle.

            Are you really this dense or are you just trolling? I'm on the cusp now.
        • scubaman5000, on 05/08/2008, -2/+6There is plenty of evidence that clearly indicates beyond reasonable doubt that a creator was not involved in the process of evolution. In fact if you use basic logic you'd be able to determine that the idea of a supreme being was made up by people in order to cope with the stress of uncertainty that is a by product of our increased intelligence.
          • StaticThunder, on 05/08/2008, -2/+6See, when you're young and the authority figure says don't go into the woods at night, you're programmed to accept that without question. Anyone who didn't got eaten by wolves. So now, when the authority figure says Obey God, same thing happens.

            Its a very important evolutionary adaptation that has been coopted by a viral meme.
          • ralphie81, on 05/08/2008, -4/+3How then did the process start?
          • scubaman5000, on 05/08/2008, -1/+6http://en.wikipedia.org/wiki/Origin_of_life
            Here's somewhere to start on your quest to find the answer. Just understand that just because you don't know does not mean "God did it".
          • ralphie81, on 05/08/2008, -1/+1I never mentioned God.
          • ApokalypseNow, on 05/08/2008, -0/+5@ralphie
            Chemistry, physics, quantum mechanics, etc. Natural processes acting out.
          • scubaman5000, on 05/08/2008, -2/+3"I never mentioned God."
            I know, and I didn't say you did. Just wanted to make that point clear to others reading this.
          • StaticThunder, on 05/09/2008, -1/+4How did the creator get started, ralphie81?
          • StaticThunder, on 05/09/2008, -1/+1I did say God. Please don't play semantic games.
  • jessestorm, on 05/08/2008, -1/+34I'm going to be the hugest nerd and say one thing: "Wow, a true chimera!"
  • mfc5200, on 05/08/2008, -7/+8Funny story about the platypus. When British zoologists were bringing the first specimens back to England, they thought it was a joke by taxidermists. Fur like a mammal, bill and feet like a duck, etc etc. Go look it up.
    • thrallie, on 05/08/2008, -0/+8not a funny story, a very common story. And that happened because the Platypus's they were bringing back were dead.
    • FPFP, on 05/08/2008, -0/+13as clearly stated in the article

      way to go numbskull
  • RobotWolf, on 05/08/2008, -0/+61FTA: "Genes for making milk, which the platypus does in mammalian style despite not having nipples."

    I'm almost scared to ask this. But where does the milk come out?
    • Nomad83, on 05/08/2008, -0/+41it just oozes out of pores and pools on the skin...you were probably better off not asking...
    • RustyJ, on 05/08/2008, -5/+1they have a sack where they tuck their udders.
    • Carmilla07, on 05/08/2008, -0/+38It's actually not that gross It just kind of leaks out of of thier skin like sweat. Milk sweat. Ok I guess that thought is a little gross.
    • MixMastaKooz, on 05/08/2008, -8/+3I don't know if Nomad is correct (sounds freaky...but with a platypus, you never know), but my first thought was that these genes were there, but not expressed.
    • Alreadyinuse99, on 05/08/2008, -0/+44It come out of the nose. But only when it laughs. That's why they are so funny looking. Otherwise they wouldn't be able to feed their young.
    • nlevend, on 05/09/2008, -0/+2If you don't know, you can't afford it.
    • Suprfire, on 05/09/2008, -5/+1In the butt
    • Suricou, on 05/09/2008, -0/+5Milk is modified sweat. Nutritious sweat evolved first, and then the glands moved together and specialised to form a nipple.
  • comat0se, on 05/08/2008, -1/+9Dugg just for the FIGURED OUT!!! part
    • liuite, on 05/08/2008, -5/+2either that or God was drunk the day he made the platypus
      • ralphie81, on 05/08/2008, -1/+4Spare parts, dude. Spare parts.
      • wonderworm, on 05/09/2008, -0/+2Educate thyself and speak not of absurdities.
    • ColonelTribune, on 05/08/2008, -0/+1At least SOMEONE likes my caps. (If only HTML tags were allowed...)
  • lepton, on 05/08/2008, -0/+6Yay, soon it'll be Platipets for all!
    • Tyrghast, on 05/09/2008, -0/+4Oh how I wish I could have a genetically modified mini-platypus.
  • robotderek42, on 05/08/2008, -0/+31Mother Nature, you cheap whore!
  • Hetman, on 05/08/2008, -0/+5I think it is awesome that the first scientist did not even beleive that the platypus existed. And they thought it was a hoax. But then again during that time you also had people trying to pass items off like the vegi mermaid "or however you sepll it." as being a real animal.
    • Alreadyinuse99, on 05/08/2008, -1/+1Fiji
    • Suricou, on 05/09/2008, -0/+2And the Megapode bird - the legless one that was said to spend its life in the air never landing. Eating, sleeping, mating, and laying it's eggs on it's mate's back to be carried until hatched. Turned out that the Megapode actually has huge legs, so big they couldn't be made to fix in the box when a skeleton was shiped back to the museum for study.
      I hear the megapode eggs make good omlette.
  • mali1, on 05/08/2008, -14/+6The Platypus seems like it was genetically engineered. The question is: by whom?
    • Fergy, on 05/08/2008, -5/+1The question is: Why even ask the question when it has been answered over and over and over
    • davidamerland, on 05/08/2008, -1/+9By the Cylons you idiot as part of their plan to distract us so they can take over the planet after they destroy Galactica!
    • bjs3171, on 05/08/2008, -1/+3Mommy N.
    • JorgeGT, on 05/08/2008, -0/+4Members of the Unseen University accidentally trapped in a time loophole, attempting to draw a creature over a stone.
    • RobbleRobble, on 05/09/2008, -1/+5Ben Stein.
  • Enasni1212, on 05/08/2008, -0/+12"There are five times more sex-determining chromosomes than scientists know what to do with."
    Great line, but I want to know what that means... do they have Q R S T U V W X Y and Z chromosomes, as opposed to just X and Y? Or do they just have sex-determining genes on ten different chromosomes?
    • wolferz, on 05/08/2008, -0/+13my guess is they have multiple sets of sex determining genes... some of them more appropriate to non-mammalian sex organs... and not all of them are actually being used

      The platypus is like what happens when you have two programs that both do different halves of what you want... so you merge the code... changing some of it so that duplicate capabilities are ignored... and then not removing the code that isn't used. So essentially the platypus is a really, REALLY dirty hack.
      • davidamerland, on 05/08/2008, -0/+3Someone was working the centripedal accelerator that day!
    • RobotWolf, on 05/08/2008, -0/+9From Wikipedia:
      "In 2004, researchers at the Australian National University discovered the Platypus has ten sex chromosomes, compared with two (XY) in most other mammals (for instance, a male Platypus is always XYXYXYXYXY).[46] Although given the XY designation of mammals, the sex chromosomes of the Platypus are more similar the ZZ/ZW sex chromosomes found in birds.[47] It also lacks the mammalian sex-determining gene SRY, meaning that the process of sex determination in the Platypus remains unknown."
      • Suricou, on 05/09/2008, -0/+1SRY is a mutation of a gene on the X chromosome. I would be interested to know if the odd creature uses the same testis-determining factor mechanism - the sex-selecting gene coding for a hormone that does nothing except for causing testis to form, with the different hormone they produce going on to control all other sex-specific characteristics. SRY only acts indirectly.
        You can make a genetically female foetus develop into a male by applying TDF at the correct moment. Such a technique has no practical use, it's just nice to know it could be done.
    • mockidol, on 05/09/2008, -0/+0Wouldn't this offer the possibility of 10 different sexs? Or does it work by by powers like 2^10 = 1024? Hell, it'd be sweet if it had one GB of sexes. But I digress...
  • shinythingy, on 05/08/2008, -16/+1and this helps humanity how?
    • iamdan1, on 05/08/2008, -0/+10Think of the possibilities, I want poisonous spurs
      • logan074, on 05/08/2008, -0/+1I just picked up a pair they are pretty sweet.
    • wolferz, on 05/08/2008, -0/+16might lead to further insight into how genes work, in addition to providing further information about evolution (like how massive jumps in evolution happen at random intervals with little or no reason or explanation
      • compcarp, on 05/08/2008, -9/+1I still don't see how that helps humanity - even if you allow for that fairy tale version of natural history.
        Do you hear yourself when you make comments like that?
        "in addition to providing further information about evolution (like how massive jumps in evolution happen at random intervals with little or no reason or explanation..."
        Evolution is full of logical, factual, holes like this that science can't come close to explaining.. because it's just plain silly. Asking a stupid question with a straight face, doesn't change the fact that it's a stupid question.
        They've found fossils of BIGGER Platypus WITH teeth in Australia and South America. What we see is DE-evolution after Creation - and animals that traveled after the flood. Not evolution and not in isolation.
      • shinythingy, on 05/08/2008, -0/+3it was a genuine question
        • Lewie, on 05/09/2008, -0/+1That may be, but you drew in a creationist, so you must be punished.
    • davidamerland, on 05/08/2008, -1/+2Well the milk as sweat thing for starters, do you not read about BDSM trends? What's wrong with you?
    • Varz, on 05/09/2008, -0/+1I heard them talking about this on the radio and they were saying they can compare the genes for say humans to the genes of a platypus, which has a very different genome, and see which parts of our DNA and the platypus DNA is the same. They can conclude that the parts that are the same must be important as two very dissimilar animals have the same genes, therefore they can go on to pinpoint what exactly these genes do and what makes them so important.
  • grodrigu, on 05/08/2008, -3/+40Half man, half bear, half pig
    • Fergy, on 05/08/2008, -4/+1George Bush is not human? What a relief.
      • davidamerland, on 05/08/2008, -2/+1The thing is he is not a platypus either, at the moment he is unclassified!
    • CaptainTater, on 05/09/2008, -1/+2You guys, he's super cereals right now.
    • stickman0287, on 05/09/2008, -0/+1no no no, its like a half bear, half manpig
    • Antipodal, on 05/09/2008, -0/+1Are you sure? Are you...HIV positive?
    • Identity4, on 05/09/2008, -0/+1150% Kickass
    • gcnaddict, on 05/09/2008, -0/+1wait, so what about spiderpig?
  • Br3ach, on 05/08/2008, -0/+2Finally, one step closer to my platypus/human hybrid army....
  • theMADone, on 05/08/2008, -1/+28the platypus: natures D student.
  • wynja, on 05/08/2008, -1/+6So what their trying to tell us is that the Platypus was the Atlanteans first attempt at genetic modification. What? You don't seriously think we're doing anything that hasn't already been done before, do you?
    • davidamerland, on 05/08/2008, -0/+2What about the ancient Etruscans and the men who built the pyramids using nothing but telekinetic powers from the outer rings of Saturn? Then Emperor ming came along and I believe the platypus was created using the power of one of his more exotic rings.
    • bjs3171, on 05/08/2008, -0/+1Yes.
    • tsunamitomi, on 05/08/2008, -0/+2"This has all happened before, and it will all happen again."
  • egoherodotus, on 05/08/2008, -7/+8how do we use this against McCain?
    • davidamerland, on 05/08/2008, -2/+2We siddle up to him and hit him with our poisonous spurs!
  • chuckstab, on 05/08/2008, -3/+7"As we learn more about things like platypuses," Wilson said, "we also learn more about ourselves and where we came from and how we work."

    I sure as hell hope not! As a species I say we distance ourselves as far away from this creature as possible.
    On the plus, the platypus is a interesting argument against the theory of intelligent design.
    • compcarp, on 05/08/2008, -11/+0"On the plus, the platypus is a interesting argument against the theory of intelligent design" Really? Show us the fossil record of where the Platypus came from. Mind, you, they've found fossils of BIGGER Platypus WITH teeth in Australia and South America. What we see is DE-evolution after Creation - and animals that traveled after the flood. Not evolution in isolation.
    • Hetman, on 05/08/2008, -0/+11There is no such thing as DE-evolution. Evolution does not have a forwards or backwards. There is no means to an end. All it matters is that an animal is able to survive and pass down its genes. It does not have to get bigger or smarter etc. The dodo bird is a great example of this. It really had no natural predators so it was fine reproducing in its natural enviroment. However when Europeans came here it was hunted to extinction. I am just saying there is no better or worst when it comes to evolution it is just change.
      • korvan504521, on 05/08/2008, -2/+1what about inbreeding and the resultant genetic problems?
      • davdev, on 05/09/2008, -0/+3It is also now noticed that Elephants are developing smaller tusks as pressure from hunters has made large tusked animals more vulnerable. Is this "de-evolution"? Of course not, it is changing based on how the environment dictates. Large, toothed playpuses may have been at some sort of environmental disadvantage and thus became smaller and lost the need for teeth.
  • grey580, on 05/08/2008, -6/+13I, for one, would like to welcome our new mammalian... errr... avian...uuuuuhhhhh REPTILIAN??? uhhh REPTIMAMAVIENTILIAN?!?!?... whatever the hell it is overlords.
  • o0joshua0o, on 05/08/2008, -1/+13Now that we have the source code for platypi, can I start a development fork? I want to make real life platypunks.
    • davidamerland, on 05/08/2008, -1/+1Dude, I know they may seem kinda cute but do you really want to f**ck them?
  • lik3n, on 05/08/2008, -0/+5SAVE ME FROM THE MONOTREMES!!!!!!

    Both of them.
    • Suricou, on 05/09/2008, -0/+1If you translate 'monotreme' you find another reason for weirdness.
  • c4171, on 05/08/2008, -0/+3Platipi have more REM sleep than any other animal, yet they're pretty dumb. REM sleep was typically associated with intelligence. So this might help figure out why.
    • indypunx, on 05/09/2008, -0/+3REM sleep increases have been linked with depression in humans. Maybe the Platypus looked in the mirror and has been depressed ever since.
  • malcolmlo, on 05/08/2008, -6/+4Not news, i could have told you all that by looking at it.

    Its a cross between a reptile, bird, and mammal. There I just saved the world time and money. Pay me.
  • Nesscz, on 05/08/2008, -1/+52To sum it up we still don't know what the ***** a platypus is...
  • docintherock, on 05/08/2008, -7/+11God had a very good laugh the day he created the Platypus. Must have created it on a Friday, right before the weekend.
    • ColonelTribune, on 05/08/2008, -0/+3You can't bury this comment. It's damn funny.
    • Rally603, on 05/09/2008, -4/+3It has the word 'God' in it. This is Digg. It's getting buried.
  • Amadeus2490, on 05/08/2008, -2/+6The Platypus Brothers were unable to be reached for comment.
  • oreonblade, on 05/08/2008, -0/+32In the beginning, there were ducks. Swimming around in the water. And then one day a couple of ducks had a retard baby. So Retard Duck goes on to make more retard babies, and then one day, a retard baby duck crawled onto the shore with its mutant fish hands and had butt sex with a squirrel or something. And then this duck-squirrel had butt sex with a lizard, and that lizard had a mutant retard baby that screwed another lizard... and that made the platypus. So there you go! It's the retarded offspring of five lizards having butt sex with a duck-squirrel.
    • ColonelTribune, on 05/08/2008, -0/+3Ha. Great quote. I remember that episode now...
    • bjs3171, on 05/08/2008, -0/+4what's that from?
      • sleeknerve, on 05/09/2008, -0/+3South Park
      • da_bradler, on 05/09/2008, -0/+3it's a re-imagining of Mr. Garisons explanation of evolution.
      • rentmitchum, on 05/09/2008, -0/+1Yea main difference is ducks instead of fish.
    • Suricou, on 05/09/2008, -0/+1It's a monotreme. Butt-sex is the only type it can do.
  • OrochiIshtar, on 05/08/2008, -1/+2I think its great that we are learning so much about the animals in our world.The Reptilian dna got me too but dose not shock me all that much. I think theres always more to the story of what we think we know about life on this planet

  • Serinitism, on 05/08/2008, -2/+1Was it gradual duck with a rat, then a snake with a walrus type deal, or a giant "look, it's a giant asteroid, we's a peeple gonna die" orgy? I'm thinking something like the South Park Christmas Critter's blood orgy... anyone?
    • Lewie, on 05/09/2008, -0/+1That was one hell of a disturbing episode, at least the first time I saw it.
  • PixelMagic, on 05/08/2008, -7/+1What if God smoked cannabis?
    Do you suppose he had a buzz,
    When he made the platypus?
  • MrPingu, on 05/08/2008, -5/+0Well its about dam time!
  • 4abtrlife, on 05/08/2008, -6/+1Cattle, mouse, rat, chicken, dog, sheep, cat, pig (on the way), drosophila, zebra fish, puffer fish, C. elegans (a nematode) are a partial list of animals whose genome has been sequenced
  • Asheis, on 05/08/2008, -7/+2wow... it's like some frankenstien monster... PART REPTILE, PART MAMMAL, PART BIRD! it's a rep-a-mam-ird!
  • SteveCUBE, on 05/08/2008, -7/+1Reptillian? Mammalian
    He's a bird-beaked, beaver-butt Australian

    Amphibious? Paradox wearing plaid socks
    Furry beetle? A bugbear, and a palezoologist's nightmare
    Symmetrical physique of disbelief

    The platypus has the brain of a dolphin
    and can be seen driving a forklift in his habitat of kelp
    He is the larva of the flatworm
    and has the ability to regenerate after injury
  • Fetching more discussions...
    Show 51 - 78 of 78 discussions
  •  

    Login or register to add a comment

    Create a new account or login to join in the conversation on Digg. You'll also be able to Digg stories to help promote things you like.


© Digg Inc. 2008 — Content posted by Digg users is dedicated to the public domain.
DIGG, DIGG IT, DUGG, DIGG THIS, Digg graphics, logos, designs, page headers, button icons, scripts, and other service names are the trademarks of Digg Inc.