What is Digg?400 Comments
- displaced1, on 05/08/2008, -1/+280Mammalian, reptilian and avian.....that must of been one hell of a threesome.
- EvansHall, on 05/08/2008, -1/+137I am not smart enough to make a joke about this ...
- inactive, on 05/08/2008, -2/+84What happens in the air, on land or in the sea stays in the air, on land or in the sea.
- SeventhSon, on 05/08/2008, -2/+74I expected the mammalian and avian parts, but the reptilian caught me off guard.
- failedprototype, on 05/08/2008, -1/+72For the love of everything good in this world, please tell me you intentionally spelled that wrong.
- casspa, on 05/08/2008, -3/+67Disclaimer: 1) a renunciation of any claim to or connection with; 2)
disavowal; 3) a statement made to save one's own ass.
Though it'll go without saying ten minutes or so into these preceedings,
View Askew would like to state that this film is from start to finish a
work of comedic fantasy, not to be taken seriously. To insist that any of
what follows is incendiary or inflammatory is to miss our intention and
pass judgement; and passing judgement is reserved for God and God alone
(this goes for you film critics too...just kidding).
So please before you think about hurting someone over this trifle of a
film, remember: even God has a sense of humor. Just look at the Platypus.
Thank you and enjoy the show.
P.S. We sincerely apologize to all Platypus enthusiasts out there who are
offended by that thoughtless comment about Platypi. We at View Askew
respect the noble Platypus, and it is not our intention to slight these
stupid creatures in any way. - RobotWolf, on 05/08/2008, -0/+62FTA: "Genes for making milk, which the platypus does in mammalian style despite not having nipples."
I'm almost scared to ask this. But where does the milk come out? - inactive, on 05/08/2008, -1/+55Birds have reptilian roots.
- Nesscz, on 05/08/2008, -1/+52To sum it up we still don't know what the ***** a platypus is...
- Alreadyinuse99, on 05/08/2008, -0/+44It come out of the nose. But only when it laughs. That's why they are so funny looking. Otherwise they wouldn't be able to feed their young.
- sockpuppets, on 05/08/2008, -1/+44Except the seamen.
- Nomad83, on 05/08/2008, -0/+41it just oozes out of pores and pools on the skin...you were probably better off not asking...
- Wonderama, on 05/08/2008, -1/+41Wow. We got from discussing platypus DNA to a threesome joke in no-time flat.
- Carmilla07, on 05/08/2008, -0/+38It's actually not that gross It just kind of leaks out of of thier skin like sweat. Milk sweat. Ok I guess that thought is a little gross.
- grodrigu, on 05/08/2008, -3/+39Half man, half bear, half pig
- inactive, on 05/08/2008, -0/+35TATATATATATATATACGATGTCGTAGTCGTAGTGCGGCTGATGCTGATGTGATGCTGAAAAAAAA
TATATATAGTGCTAGTCGTAGTCGTAGTGCGGCTAGTCGATATGAGCTGTCTGATCGTATAAAAAA
and so on, and so forth. - alpha19, on 05/08/2008, -1/+36Finally I can sleep at night...
- inactive, on 05/08/2008, -0/+35Can someone paste the code so we can pizz off the MPAA again?
- LongShlong, on 05/08/2008, -0/+33Jurassic Park will answer all your questions.
- jessestorm, on 05/08/2008, -1/+34I'm going to be the hugest nerd and say one thing: "Wow, a true chimera!"
- oreonblade, on 05/08/2008, -0/+32In the beginning, there were ducks. Swimming around in the water. And then one day a couple of ducks had a retard baby. So Retard Duck goes on to make more retard babies, and then one day, a retard baby duck crawled onto the shore with its mutant fish hands and had butt sex with a squirrel or something. And then this duck-squirrel had butt sex with a lizard, and that lizard had a mutant retard baby that screwed another lizard... and that made the platypus. So there you go! It's the retarded offspring of five lizards having butt sex with a duck-squirrel.
- SpectralSounds, on 05/08/2008, -0/+31= 0
- robotderek42, on 05/08/2008, -0/+31Mother Nature, you cheap whore!
- pedepy, on 05/08/2008, -3/+32i hear it also has ties with rev. Wright.
- theMADone, on 05/08/2008, -1/+29the platypus: natures D student.
- Stradenko, on 05/08/2008, -0/+27France.
- ironicsans, on 05/08/2008, -0/+25Duck billed platypus has feet like a duck but is furry. It's all in my Wildlife Treasury!
- Carmilla07, on 05/08/2008, -1/+24mammals evolved from reptiles. Just like birds also evolved from reptiles. Monotremes are some of the most primitive mammals so it makes sense that it would have reptilian genes.
- inactive, on 05/08/2008, -6/+29:Shrug: Even the Colonel makes mistakes. (Although I can't believe I made that one.) Feel free to bury me, if you haven't already. I deserve it.
- Someguy101, on 02/19/2009, -1/+24You sir are an idiot.
- IphtashuFitz, on 05/08/2008, -2/+25That's because the platypus is the joke itself. A joke perpetrated by Mother Nature. And you should never fool with Mother Nature! (or try to out-joke her)
- ClevelandBrown, on 05/08/2008, -0/+22And that surprises you?
- MikeXpop, on 05/09/2008, -1/+23You misspelled "awesome"
- Wonderama, on 05/08/2008, -1/+21No...no, I guess it shouldn't.
- bjs3171, on 05/08/2008, -0/+20that. is ***** disgusting.
- 3gibberish4q57, on 05/08/2008, -3/+22To be honest, I dugg it down because of the phrase "super-duper".
- inactive, on 05/08/2008, -4/+23Life will find a way
- inactive, on 05/08/2008, -2/+21God creates dinosaurs. God destroys dinosaurs. God creates Man. Man destroys God. Man creates dinosaurs.
- inactive, on 05/08/2008, -2/+21've
- Lyk4n, on 05/08/2008, -2/+19Giggity gig.
- praisethelard, on 06/06/2008, -3/+20And while you're at it, can anyone explain to me why "colonel" is pronounced "kernel"?!
- sgtbutterscotch, on 05/08/2008, -0/+17I'm surprised at you sockpuppets. That was terrible.
- Kisama, on 05/08/2008, -1/+18Oh my Science!
- wolferz, on 05/08/2008, -0/+16might lead to further insight into how genes work, in addition to providing further information about evolution (like how massive jumps in evolution happen at random intervals with little or no reason or explanation
- ApokalypseNow, on 05/08/2008, -1/+17"You have been given every reason to believe that intelligence was absolutely necessary"
Name one reason. - wontstoptalking, on 05/08/2008, -0/+14Great Scott!
- verifex, on 05/08/2008, -0/+14http://www.chicagotribune.com/news/chi-platypus-ec ...
The story without all the irrelevant pictures and advertising. - StaticThunder, on 05/08/2008, -2/+15Evolution is intelligent. Very few seem to understand what intelligence means. Intelligence means that you search for solutions to problems. Thats ALL it is. Its not some magical thing. You can search with a neural net (which is generally a nonlinear regression) or you can use case based reasoning, or bayesian inference, whatever, but ultimately even a random walk that evaluates each position on the space it traverses against some criterion is an intelligent process.
Evolution searches for solutions to the problem of reproductive fitness. It doesn't have a brain, but it doesn't matter. Every living organism is a potential solution being tested.
People keep saying life looks designed. IT WAS! By selection for reproductive fitness! - FPFP, on 05/08/2008, -0/+13as clearly stated in the article
way to go numbskull -
Show 51 - 100 of 397 discussions
Browsing Digg on your phone just got easier with our enhancements to the 
© Digg Inc. 2009
— Content created and posted by Digg users is