Discover and share the best of the web!
Learn more about Digg by taking the tour.
Creationists sneak into Genbank?
ncbi.nlm.nih.gov — Is this a ruse, or a real attempt by the creationists to try to show that proteins are "intelligently designed"? Notice this protein was submitted by the Discovery Institute, the protein is from one of Darwin's Finches, the author on the paper is "A. Moses" and the country is "Israel:Mount Sinai".
gordonj- 20 diggs
- digg it
- gordonj, on 06/24/2008, -1/+9If you translate the DNA into the different frames, you get the following for the -1 frame:
>gi|172046474:28-4887 Geospiza fortis mRNA for Com10 protein ATGACCGATTTCGTTTTAGTAGTGGGTTTAAGAGATTTAGGTAGCGTGGGTTTAACCGTTGATGTGGG, 1556 bases, 266A checksum.
LQRD*THY*GQD*WHICH*HAVE*PRQVGHT*THEE*QVT*QF*THE*LA
ND*QF*EGYPT*QVT*QF*THE*HQVSE*QF*PQNDAGE***THQV*SHA
LT*HAVE*NQ*QTHER*GQDS*PEFQRE*ME***THQV*SHALT*NQT*M
AKE*VNTQ*THEE*ANY*GRAVEN*IMAGE*QR*ANY*LIKENESS*QF*
ANY*THING*THAT*IS*IN*HEAVEN*APQVE*QR*THAT*IS*IN*TH
E*EARTH*PENEATH*QR*THAT*IS*IN*THE*WATER*VNDER*THE*
EARTH***THQV*SHALT*NQT*PQW*DQWN*THYSELF*TQ*THEM*NQ
R*SERVE*THEM*FQR*I*THE*LQRD*THY*GQD*AM*A*IEALQVS*G
QD*VISITING*THE*INIQVITY*QF*THE*FATHERS*VPQN*THE*C
HILDREN*VNTQ*THE*THIRD*AND*FQVRTH*GENERATIQN*QF*TH
EM*THAT*HATE*ME*AND*SHEWING*MERCY*VNTQ*THQVSANDS*Q
F*THEM*THAT*LQVE*ME*AND*KEEP*MY*CQMMANDMENTS***THQ
V*SHALT*NQT*TAKE*THE*NAME*QF*THE*LQRD*THY*GQD*IN*V
AIN*FQR*THE*LQRD*WILL*NQT*HQLD*HIM*GVILTLESS*THAT*
TAKETH*HIS*NAME*IN*VAIN***REMEMPER*THE*SAPPATH*DAY
*TQ*KEEP*IT*HQLY**SIX*DAYS*SHALT*THQV*LAPQVR*AND*D
Q*ALL*THY**QRK**PVT*THE*SEVENTH*DAY*IS*THE*SAPPATH
*QF*THE*LQRD*THY*GQD*IN*IT*THQV*SHALT*NQT*DQ*ANY*W
QRK*THQV*NQR*THY*SQN*NQR*THY*DAVGHTER*THY*MANSERVA
NT*NQR*THY*MAIDSERVANT*NQR*THY*CATTLE*NQR*THY*STRA
NGER*THAT*IS*WITHIN*THY*GATES**FQR*IN*SIX*DAYS*THE
*LQRD*MADE*HEAVEN*AND*EARTH*THE*SEA*AND*ALL*THAT*I
N*THEM*IS*AND*RESTED*THE*SEVENTH*DAY*WHEREFQRE*THE
*LQRD*PLESSED*THE*SAPPATH*DAY*AND*HALLQWED*IT***HQ
NQVR*THY*FATHER*AND*THY*MQTHER*THAT*THY*DAYS*MAY*P
E*LQNG*VPQN*THE*LAND*WHICH*THE*LQRD*THY*GQD*GIVETH
*THEE***THQV*SHALT*NQT*KILL***THQV*SHALT*NQT*CQMMI
T*ADVLTERY***THQV*SHALT*NQT*STEAL***THQV*SHALT*NQT
*PEAR*FALSE*WITNESS*AGAINST*THY*NEIGHPQVR***THQV*S
HALT*NQT*CQVET*THY*NEIGHPQVRS*HQVSE*THQV*SHALT*NQT
*CQVET*THY*NEIGHPQVRS*WIFE*NQR*HIS*MANSERVANT*NQR*
HIS*MA
It's from Exodus 20 apparently. Pity God designed the genetic code to only have 20 amino acids, yet he allowed english to develop with 26 letters.- Fordi, on 06/24/2008, -2/+4I don't get it. This sequence was forged to translate into the commandments?
- gordonj, on 06/25/2008, -0/+6Yeah, as an April fools joke I think (look at the submission date of the paper). There's no way the creationists could actually get away with something like that. It would be way too simple to try to amplify the same gene in the same organism (and fail), that they would never be able to replicate it independently. The only way they could do it would be to genetically engineer the whole population to contain this gene and then try to do something like this.
- eir574, on 06/26/2008, -1/+2Do you think this is the work of the Discovery Institute, or is it a joke at their expense? Theoretically, you need someone on the inside since all genbank submissions are reviewed (Richard Sternberg might be an option, as he's listed as staff at Genbank).
- gordonj, on 06/26/2008, -0/+3I'd wager it wasn't the discovery institute. As far as the reviewing of Genbank records goes, I'm not sure whether something like this would be all that easy to detect unless you were paying close attention to it. The alarm bells should go off when seeing the institute that it was submitted by, but if you had to review records all day I imagine it would be easy to let something like this slip by. It appears to just be a random gene that translates into a random protein. I've never submitted to Genbank myself, only to EMBL, as I've heard Genbank submissions are a pain in the ass.
- eir574, on 06/26/2008, -1/+3"Genbank submissions are a pain in the ass."
Try submitting to GEO. My lab spends an inordinate amount of time on that. Someone once joked that we should just give back our grant money rather than continue having to deal with them. - eir574, on 06/26/2008, -1/+3Dugg down for complaining about GEO? If you work for GEO, I'm sure this is not the first time you've heard that your submission process is a wee bit cumbersome . . . :)
- gordonj, on 06/25/2008, -0/+6Yeah, as an April fools joke I think (look at the submission date of the paper). There's no way the creationists could actually get away with something like that. It would be way too simple to try to amplify the same gene in the same organism (and fail), that they would never be able to replicate it independently. The only way they could do it would be to genetically engineer the whole population to contain this gene and then try to do something like this.
- wonderchemist, on 06/25/2008, -0/+1The bible was written in English?
- gordonj, on 06/25/2008, -0/+5Clearly God knew that by the time we had genome sequencing technology, the international language of science would be english and thus planned ahead...
- StaticThunder, on 06/25/2008, -0/+3How did you find this record Gordon?
- gordonj, on 06/26/2008, -1/+3It was passed on to me by a friend. She didn't tell me where she came across it though.
- StaticThunder, on 06/26/2008, -0/+2EMBL was interested in knowing. The person who approved it didn't notice its unusual features. He said they all got a good laugh out of it and it will be removed, and thanks for bringing it to their attention.
- Fordi, on 06/24/2008, -2/+4I don't get it. This sequence was forged to translate into the commandments?
- bitterbug, on 06/24/2008, -1/+3I wonder if you took a million moneys and translated their DNA if you'd get the complete works of Shakespeare.
- Bilabrin, on 06/24/2008, -2/+1I know you meant "Monkeys" there but you got me thinking about the amount of DNA which must be on money from all the dead skin cells. They could probably get just about everone that way, in no particular order.
- bitterbug, on 06/24/2008, -1/+2Doh. Yeah, I missed the typo.
And interesting point. I wonder what kind of DNA profile could be built from an analysis of a 20 dollar bill.
- bitterbug, on 06/24/2008, -1/+2Doh. Yeah, I missed the typo.
- Bilabrin, on 06/24/2008, -2/+1I know you meant "Monkeys" there but you got me thinking about the amount of DNA which must be on money from all the dead skin cells. They could probably get just about everone that way, in no particular order.
- sgiffy, on 06/24/2008, -1/+5It looks like a joke, or bait for creationists. Pretty clever though.
- gordonj, on 06/24/2008, -1/+5Haha, just saw the date on the submission is 1st of April. I guess it really is a joke after all!
- StaticThunder, on 06/24/2008, -1/+6*****. These databases are paid for by taxpayers and are not intended to be propaganda outlets for disingenuous assholes. I hope there are criminal charges brought against whoever took it upon themselves to submit this record.
- eir574, on 06/24/2008, -2/+5It really is obnoxious. It's probably not going to affect people who need a specific sequence from genbank, but if I were doing some sort of analysis involving all protein sequences in genbank, I'd be pretty annoyed. I'd be particularly annoyed if they'd given others the idea that it's okay to screw with people by entering fake sequences into genbank (combined with fake references to publications -- I assume these people's supposed paper is not actually in press at Protein Science).
- StaticThunder, on 06/24/2008, -1/+5This one record probably does nothing, and I already sent a note to NCBI saying they might want to review this record -- of course they don't ever delete records, they just deprecate them -- but whats to stop the discovery institute from planting conserved regions in the middle of these fake sequences and messing up everyone's BLAST results.
They are interfering with a tax payer funded government service. Its no different then tampering with the mail, or denying access to a government building.
And no, I looked for this paper, its nowhere to be found.- eir574, on 06/24/2008, -2/+5I looked for it, too, but I've published in Protein Science a couple of times and it wouldn't necessarily be suspicious that an article that was in press in April has still not appeared in the journal. I still sincerely doubt that the paper is real, though.
I would hope that NCBI would consider deleting a record that was entered purely as a fraudulent activity. I hope they will also flag any entries from the Discovery Institute for manual curation before entering them into the database. Clearly, the Discovery Institute is not above fraud. Is anyone surprised? - eir574, on 06/24/2008, -2/+4Hmm . . . my husband is convinced that the Discovery Institute wouldn't have done this themselves because it's just so obviously fraudulent. If not, though, I wonder how it was done. Genbank reviews every submission, so it might take someone on the inside to get this done. (I'm sure they don't have the staff necessary to make sure that every single entry is legitimate and is free of mistakes, but there are certainly some things in this particular entry that should have caught someone's eye.) Interestingly, Richard Sternberg works for Genbank, so the Discovery Institute did have a man on the inside.
- gordonj, on 06/25/2008, -0/+4I think it's just an April fools prank. The submission date says 1st of April, and combined with the gene name (COM10, i.e. 10 Commandments), the submitter being Moses, the location of Mount Sinai, the organism being one of Darwin's Finches, the title of the paper drawing you to look at frame shifts in the gene sequence really all just seems a little too convenient to be an actual attempt at creationist subversion.
- eir574, on 06/24/2008, -2/+5I looked for it, too, but I've published in Protein Science a couple of times and it wouldn't necessarily be suspicious that an article that was in press in April has still not appeared in the journal. I still sincerely doubt that the paper is real, though.
- StaticThunder, on 06/24/2008, -1/+5This one record probably does nothing, and I already sent a note to NCBI saying they might want to review this record -- of course they don't ever delete records, they just deprecate them -- but whats to stop the discovery institute from planting conserved regions in the middle of these fake sequences and messing up everyone's BLAST results.
- eir574, on 06/24/2008, -2/+5It really is obnoxious. It's probably not going to affect people who need a specific sequence from genbank, but if I were doing some sort of analysis involving all protein sequences in genbank, I'd be pretty annoyed. I'd be particularly annoyed if they'd given others the idea that it's okay to screw with people by entering fake sequences into genbank (combined with fake references to publications -- I assume these people's supposed paper is not actually in press at Protein Science).
Digg is coming to a city (and computer) near you! Check out all the details on our 
© Digg Inc. 2008 —
Content posted by