What is Digg?27 Comments
- duddles, on 01/23/2008, -0/+7Very cool. I'm at Wash U where we have a solexa sequencer next door that can sequence gigabases at a time, and the whole thing fits on one table (compared to the rooms of sanger sequencers and colony pickers on the floor below). I'm not sure how the graph looks now, but sequencing efficiency might be outpacing Moore's law...
- nullcodes, on 01/23/2008, -0/+6This, plus the cancer genome will be awesome. http://cancergenome.nih.gov/
- brasso, on 01/23/2008, -0/+6How many gnomes did they find?
- sockpuppets, on 01/23/2008, -0/+5People shorter than 24" are encouraged to participate in the 1000 Lawn Gnomes project instead.
- topoisomerase, on 01/23/2008, -0/+4i was saddened to realize this did not translate to something amusing in amino acid space. sadder still is that i did such a thing at all.
- sfrench, on 01/23/2008, -1/+4You didn't denote whether this is 5'->3' or 3'->5'
- maheshee11, on 01/23/2008, -1/+4From the guardian.co.uk article
"The project will begin this year with three pilot studies. The first will involve an in-depth scan of two families comprising two parents and one child. The second will sequence the genomes of 180 people, while the third will examine 1,000 genes in 1,000 people.
The main project will begin next year, with DNA sequencing machines reading roughly 8.2 billion letters a day - the equivalent of more than two human genomes every 24 hours.
The sequencing will be conducted at five major sites around the world, including the Sanger Centre, the US National Human Genome Research Institute (NHGRI) and the Beijing Genomics Institute in China." - inactive, on 01/23/2008, -3/+6AGCGAGCGCGAGCGCGAGCGCGCGAGCGACAAGAGAGCGACGACGACGAGCGACG
- topoisomerase, on 01/23/2008, -0/+3well, it's a complex question after all. thankfully there are a number of different and complementary platforms out there these days. 454 has the long reads needed for de novo assembly and guys like illumina and ABI will fight over short read resequencing. that's just the tip of the iceberg of course. it will be interesting to see how things flesh out over the next few years. that said, you're point is well taken. we must consider quality to be paramount importance. cost & yield are certainly important but they ain't everything, despite what the short read platforms claim.
- Easyoffbam, on 01/23/2008, -0/+3I hate how a video of an ape drinking its own piss can get dugg more than this.
- sockpuppets, on 01/23/2008, -0/+3God bless you.
- nullcodes, on 01/23/2008, -0/+3Somebody has to pay for the initial research. Do you think the research that goes into inventing something is free? If nobody is willing to invest in needed research .. the technology will stagnate. Also, obviously if there was a known way to make it cost dramatically less they would be doing that (yes, i know there are companies who claim they will be able to do it for $100 in 5 years). But would you sit around waiting for flying cars or do you own a car now? This project will not only save lives, but improve quality of life of many people. Human lives are always worth saving. The sooner the better. Who knows, it may even extend the life of people who will help invent $100 genome sequencing.
- sfrench, on 01/23/2008, -0/+2According to a press release, the other two sites are:
Washington University Genome Sequencing Center at the Washington University School of Medicine in St. Louis
Human Genome Sequencing Center at the Baylor College of Medicine in Houston.
http://www.nih.gov/news/health/jan2008/nhgri-22.ht ... - Privil3g3, on 01/23/2008, -0/+2"The detailed map of human genetic variation will be used by many researchers seeking to relate genetic variation to particular diseases. In turn, such research will lay the groundwork for the personal genomics era of medicine, in which people routinely will have their genomes sequenced to predict their individual risks of disease and response to drugs."
- can that predict contraction of chlamydia? that ***** is everywhere - duddles, on 01/23/2008, -0/+2True, but most future sequencing projects will be resequencing or metagenomics so it's all good.
- SupaFurry, on 01/23/2008, -0/+2Someone's got a bad case of the microsatellites.
- SupaFurry, on 01/23/2008, -0/+2Every time a new sequencing technology comes along the reads get shorter and the quality of the full assembled genome goes down. No future genomes are going to be done with the care of the initial ones. We're sacrificing quality for speed.
- Gaulven, on 01/23/2008, -2/+3Not too many Ts in there :-/
- BigBallistix, on 01/23/2008, -1/+2I'd rather a humanoid gnome than a cloned mini-me. All this science, so many opportunities for finding loop-holes in human rights and playing gnome/dwarf soccer.
- twiztidsinz, on 01/23/2008, -1/+2Psh... 1000 Gnomes would be more impressive
- inactive, on 01/23/2008, -0/+1GATTACA
- peter303, on 01/23/2008, -0/+1Clone him back!
- furi0us1, on 01/23/2008, -0/+1Wasn't it just a few years ago when it was a big deal to map the genome of a single human? Why did we waste 100 million (just an example, I don't know the actual figure) doing that when just a few years later it would be possible to do 1000 at a time? Why not just wait a few more years until we can map anyone's genome easily?
- mrpoll, on 01/23/2008, -2/+1My genome is good stuff. You should come buy some.
Quick Poll on Genome my brothers and sisters: http://couchmob.com/read/life/17
You know your vote counts. - invinciblechunk, on 01/23/2008, -3/+2Whack off for science!
- cricketsymphony, on 01/23/2008, -5/+3WHO CARES
HEATH LEDGER IS DEAD
< / sarcasm>
The Digg Toolbar for Firefox lets you Digg, submit content, and keep track of Digg even when you're not on the Digg site. Download the official 
© Digg Inc. 2009
— Content created and posted by Digg users is